View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-16 (Length: 180)
Name: NF4277-Insertion-16
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 3 - 176
Target Start/End: Complemental strand, 12229140 - 12228967
Alignment:
| Q |
3 |
acaaggaaagcagtcaagtatttgagagtttcctcagtgttttgtaaattttcgggtttatctcgaaagagcatgtatggatttatgtatgcaatatgca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
12229140 |
acaaggaaagcagtcaagtatttgagagtttcctcagtgttttgtaaattttcgggtttatctcgaaagagcatgtatgtatttatgtatgcattatgca |
12229041 |
T |
|
| Q |
103 |
atatcaatttccagcagttttgaacagctaacaaggcaaatgctgcatgttacgaaaaacaacgaactgcgttc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12229040 |
atatcaatttccagcagttttgaacagctaacaaggcaaatgctgtatgttacgaaaaacaacgaactgcgttc |
12228967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University