View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-22 (Length: 191)
Name: NF4277-Insertion-22
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 191
Target Start/End: Original strand, 29137169 - 29137337
Alignment:
| Q |
23 |
caccaaggaagttacgaatctcaatagcagaattggtattcgtaatactagcattgatgggaaaatgtgcatatacaaaacgcatcttgtaacggtaacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29137169 |
caccaaggaagttacgaatctcaatagcagaattggtattcgtaatactagcattgatgggaaaatgtgcatatacaaaacgcatcttgtaacggtaacc |
29137268 |
T |
|
| Q |
123 |
cttagtaacaccagtgatgagattatcaacatgactaagagcagttcgaatggcagcagaggttttcct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29137269 |
cttagtaacaccagtgatgagattatcaacatgactaagagcagttcgaatagcagcagaggttttcct |
29137337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 70 - 191
Target Start/End: Complemental strand, 42567091 - 42566970
Alignment:
| Q |
70 |
ctagcattgatgggaaaatgtgcatatacaaaacgcatcttgtaacggtaacccttagtaacaccagtgatgagattatcaacatgactaagagcagttc |
169 |
Q |
| |
|
||||| |||||||| ||||| ||||| ||||| | ||||||||| ||| | ||||| || ||||||||||||||||| ||||| || || ||||| || | |
|
|
| T |
42567091 |
ctagcgttgatggggaaatgagcatacacaaacctcatcttgtagcggaatcccttggtgacaccagtgatgagattctcaacgtggctgagagctgtcc |
42566992 |
T |
|
| Q |
170 |
gaatggcagcagaggttttcct |
191 |
Q |
| |
|
||||| || ||||||||||| |
|
|
| T |
42566991 |
tgatggcggcggaggttttcct |
42566970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 167
Target Start/End: Complemental strand, 10785346 - 10785249
Alignment:
| Q |
70 |
ctagcattgatgggaaaatgtgcatatacaaaacgcatcttgtaacggtaacccttagtaacaccagtgatgagattatcaacatgactaagagcagt |
167 |
Q |
| |
|
||||| ||||| |||||||| ||||| ||||| | ||||||||| || ||||||| || ||||||||||||||||| || || || || |||||||| |
|
|
| T |
10785346 |
ctagcgttgattggaaaatgagcatacacaaacctcatcttgtagcgaaaacccttggtgacaccagtgatgagattctcgacgtggctgagagcagt |
10785249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University