View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-28 (Length: 204)
Name: NF4277-Insertion-28
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-28 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 36530296 - 36530500
Alignment:
| Q |
1 |
tcatgtctataccactgtgtttgtgatgttagcttttatgcttgtctatttatttagggttcgattatttagaaattgttgagaaattaatttcatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36530296 |
tcatgtctataccactgtgtttgtgatgttagcttttatgcttgtctatttatttagggttcgattatttagaaattgttgagaaattaatttcatttta |
36530395 |
T |
|
| Q |
101 |
gttaatgtctgctagtctagaagttctgagattgattggattttattcaatggattgtattagattttactctt-aaatttcagcggattgtaaatggat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36530396 |
gttaatgtctgctagtctagaagttctgagattgattggattttattcaatggattgtattagattttactcttaaaatttcagcggattgtaaatggat |
36530495 |
T |
|
| Q |
200 |
tgttt |
204 |
Q |
| |
|
||||| |
|
|
| T |
36530496 |
tgttt |
36530500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University