View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-30 (Length: 200)
Name: NF4277-Insertion-30
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 2 - 198
Target Start/End: Original strand, 576090 - 576286
Alignment:
| Q |
2 |
aaaagaggcaacaattcatagactttgtagagaagttgcttcagttttgtaatacttcaagcctaaaaaagttttctctattttttgaagttggtatgga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576090 |
aaaagaggcaacaattcatagactttgtagagaagttgcgtgtgttttgtaatacttcaagcctaaaaaagttttctctattttttgaagttggtatgga |
576189 |
T |
|
| Q |
102 |
agcacctagggttaataaatggctaagtatttttgttaaccctaatattgaagaattaaaccttgaactttatacagttaaggaaccacttgttctc |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
576190 |
agcacctagggttactaaatggctaagtatttttgttaaccctaatattgaagaattaaagcttgaactttatacagttaaggaaccacttgttctc |
576286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University