View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-32 (Length: 72)
Name: NF4277-Insertion-32
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 9 - 72
Target Start/End: Original strand, 53251269 - 53251332
Alignment:
| Q |
9 |
gaaacaacctcccatctgcttgaagttcctttgggaaactttcgtattccttttctcaatagct |
72 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53251269 |
gaaacaacctcccatctccttgaagttcctttgggaaactttcgtattccttttctcaatagct |
53251332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 9 - 72
Target Start/End: Original strand, 53236851 - 53236914
Alignment:
| Q |
9 |
gaaacaacctcccatctgcttgaagttcctttgggaaactttcgtattccttttctcaatagct |
72 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53236851 |
gaaacaacctcccatctccttgaagttcctttgggaaacttttgtattccttttctcaatagct |
53236914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 6e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 9 - 72
Target Start/End: Original strand, 44740935 - 44740998
Alignment:
| Q |
9 |
gaaacaacctcccatctgcttgaagttcctttgggaaactttcgtattccttttctcaatagct |
72 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44740935 |
gaaacaacctcccatctccttgaagttcctttgggaaacttttgtattccttttctcaatagct |
44740998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University