View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-8 (Length: 301)
Name: NF4277-Insertion-8
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 5 - 301
Target Start/End: Original strand, 44908559 - 44908854
Alignment:
| Q |
5 |
agatacttagtttttgtagcaaaaagtatataatttgagttgagtttgaggctgcttgacttgagtttatgcattgtatactatgtcttatgtggtgaca |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908559 |
agatacttagtttt-gtagcaaaaagtatataatttgagttgagtttgagtctgcttgacttgagtttatgcattgtatactatgtcttatgtggtgaca |
44908657 |
T |
|
| Q |
105 |
gtacatatttacacagtatatttgatgttatcttggtgtttatgtcactgaataattgagcctttttctattaatcatcaaattattatgtttactactt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908658 |
gtacatatttacacagtatatttgatgttatcttggtgtttatgtcactgaataattgagcctttttctattaatcatcaaattattatgtttactactt |
44908757 |
T |
|
| Q |
205 |
tacttcatttagctagaaagacccttgggaaacaacaactttcataccatagaacaaagtaatcaatctcggtcattgattcgcaatcagacggttc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908758 |
tacttcatttagctagaaagacccttgggaaacaacaactttcataccatagaacaaagtaatcaatctcggtcattgattcgcaatcagacggttc |
44908854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University