View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4277_high_13 (Length: 250)

Name: NF4277_high_13
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4277_high_13
NF4277_high_13
[»] chr2 (1 HSPs)
chr2 (1-236)||(20210217-20210452)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 20210217 - 20210452
Alignment:
1 aattgaatatctagggtaccctccaaatgctgagtcactaagatgtctactttaggtggatatatggaagtnnnnnnnnnnnngggttctgcttgataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||            ||||| |||||||||||    
20210217 aattgaatatctagggtaccctccaaatgctgagtcactaagatgtctactttaggtggatctatggaagtaaaaacaaaaaagggttttgcttgataaa 20210316  T
101 gcatgtagcttggaccacaataattttacctaaagtagaattatgggaccatagaaacaaatcacaaaccttgctcatgtgtcatatgaatgtatgcaaa 200  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20210317 gcatttagtttggaccacaataattttacctaaagtagaattatgggaccatagaaacaaatcacaaaccttgctcatgtgtcatatgaatgtatgcaaa 20210416  T
201 cttaggcctttcaaaccaatcattgctttccatagt 236  Q
    ||||||||||||||||||||||||||||||||||||    
20210417 cttaggcctttcaaaccaatcattgctttccatagt 20210452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University