View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277_high_8 (Length: 350)
Name: NF4277_high_8
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 335
Target Start/End: Complemental strand, 42965541 - 42965215
Alignment:
| Q |
5 |
ttatattatttgaatgaaaaaaggtacgaatag--gtagttgggtgtcctaatgctaatagctaatgacccatatttctcacaataatgatacattatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42965541 |
ttatattatttgaatgaaaaaaggtacgaatagaggtagttgggtgtcctaat------agctaatgacccatatttctcataataatgatacattatta |
42965448 |
T |
|
| Q |
103 |
tattaccttaatttgcctaaggatcatactaggatgtagacatatcttaggtatttatatatgttgtgcacacacaaaacaagaccaaccaaaggaagcc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42965447 |
tattaccttaatttgcctaaggatcatactacgatgtagacatattttaggtatttatatatgttgtgcacacacaaaacaagaccaaccaaaggaagcc |
42965348 |
T |
|
| Q |
203 |
acttagaggttgcaaatcagcttcttcggtgagtgagtgagtgctcttctgtcactgtatacccaccaatggcaactcttggtgctgtcaaattcctgct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42965347 |
acttagaggttgcaaatcagcttcttcggtgagtgagtgagtgctcttctgtcactgtatacccaccaatggcaactcttggtgctgtcaaattcctgct |
42965248 |
T |
|
| Q |
303 |
ctgtctccttatgatatggctcatcaactttct |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42965247 |
ctgtctccttatgatatggctcatcaactttct |
42965215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University