View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277_low_19 (Length: 229)
Name: NF4277_low_19
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277_low_19 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 105 - 229
Target Start/End: Original strand, 11343793 - 11343914
Alignment:
| Q |
105 |
gccacatgtcacgcagctaagagttggg-taaatggaggtttcataaatggagggaagatgaattccatatacacacaatagagagagaaagaaagaaca |
203 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
11343793 |
gccacatgtcacccatataagagttggggtaaatggaggtttcataaatggagggaagatgaactccatatacacacaat----agagaaagagagaaca |
11343888 |
T |
 |
| Q |
204 |
tgaataacaaagatggctaaggtttc |
229 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
11343889 |
tgaataacaaagacggctaaggtttc |
11343914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 11343689 - 11343731
Alignment:
| Q |
1 |
gtcgtgtgaagtttgaaccagaagagtaagtgcgtgtgacttc |
43 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11343689 |
gtcgtgtgaagtttgaactagaagagtaagtgcgtgtggcttc |
11343731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University