View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277_low_20 (Length: 219)
Name: NF4277_low_20
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 31805459 - 31805666
Alignment:
| Q |
1 |
gtataggtaaataatactaatcttttactacttcactttagcaccgatacttttgatcgaatgtctatgtgttctcgtctgacaccgtcgacgtataatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31805459 |
gtataggtaaataatactaatcttttactacttcactttagcaccgatacttctgatcgaatgtctatgtgttctcgtctgacactgtcgat-tataatg |
31805557 |
T |
|
| Q |
101 |
attacattcaattatgtcattttatcatattattacaccggtcaaatcattttgaccaacgacattgtagtgtcttgttcgatatacatgtaaccgtgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31805558 |
attacattcaattatgtcattttatcatattattacaccggtcaaattatttcaaccaacgacattgtagtgtcttgttcgatatacatgtaaccgtgtt |
31805657 |
T |
|
| Q |
201 |
tgtgctgct |
209 |
Q |
| |
|
|||| |||| |
|
|
| T |
31805658 |
tgtgttgct |
31805666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 135
Target Start/End: Original strand, 2493426 - 2493465
Alignment:
| Q |
96 |
taatgattacattcaattatgtcattttatcatattatta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
2493426 |
taatgattacattcaattatgtcattttgtcaaattatta |
2493465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 135
Target Start/End: Original strand, 27096013 - 27096052
Alignment:
| Q |
96 |
taatgattacattcaattatgtcattttatcatattatta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
27096013 |
taatgattacattcaattatgtcattttgtcaaattatta |
27096052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 2976739 - 2976701
Alignment:
| Q |
98 |
atgattacattcaattatgtcattttatcatattattac |
136 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
2976739 |
atgattacattcaattatgtcattttctcaaattattac |
2976701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 8457969 - 8457932
Alignment:
| Q |
99 |
tgattacattcaattatgtcattttatcatattattac |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
8457969 |
tgattacattcaattatgtcattttctcaaattattac |
8457932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 98 - 135
Target Start/End: Complemental strand, 8017531 - 8017494
Alignment:
| Q |
98 |
atgattacattcaattatgtcattttatcatattatta |
135 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8017531 |
atgattacactcaattatgtcattttttcatattatta |
8017494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 132
Target Start/End: Complemental strand, 32843757 - 32843724
Alignment:
| Q |
99 |
tgattacattcaattatgtcattttatcatatta |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
32843757 |
tgattacattcaattatgtcattttctcatatta |
32843724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University