View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4278-Insertion-16 (Length: 61)
Name: NF4278-Insertion-16
Description: NF4278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4278-Insertion-16 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 5445984 - 5445933
Alignment:
| Q |
10 |
caataactgtttgtgaagatgaagaaagtaacctctttgctttctcacatgc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445984 |
caataactgtttgtgaagatgaagaaagtaacctctttgctttctcacatgc |
5445933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.00000006
Query Start/End: Original strand, 29 - 61
Target Start/End: Original strand, 5440705 - 5440737
Alignment:
| Q |
29 |
tgaagaaagtaacctctttgctttctcacatgc |
61 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
5440705 |
tgaagaaggtaacctctttgctttctcacatgc |
5440737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University