View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4278-Insertion-19 (Length: 178)
Name: NF4278-Insertion-19
Description: NF4278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4278-Insertion-19 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 6 - 178
Target Start/End: Complemental strand, 41240587 - 41240415
Alignment:
| Q |
6 |
aggatttcatgaccgcactgcagtcagacacatctggaccatccaattaagattgaacaaaccagattttaagctcgaatttgaacttaaaatttggacc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41240587 |
aggatttcatgaccgcactgcagtcagacacatctggaccatccaattaagattggacaaaccagattttaagctcgaatttgaacttaaaatctggacc |
41240488 |
T |
|
| Q |
106 |
acctgatattaattaactggattgcccagatgtgttggttgtagtgcaatcaactatactcaatccaaatcta |
178 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41240487 |
acctgatattaattaactggattgcctagatgtgttggttgtagtgcaatcaactatattcaatccaaatcta |
41240415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 41247229 - 41247382
Alignment:
| Q |
18 |
ccgcactgcagtcagacacatctggaccatccaattaagattgaacaaaccagattttaagctcgaatttgaacttaaaatttggaccacctgatattaa |
117 |
Q |
| |
|
||||||| || |||| |||||||| |||||| ||||||||| | | || ||||||||||| ||||| ||||||||||||| |||| ||||| |||| |
|
|
| T |
41247229 |
ccgcactacaatcagtcacatctgaaccatctaattaagatcggagaattcagattttaagttcgaaattgaacttaaaatccaaaccatctgatcttaa |
41247328 |
T |
|
| Q |
118 |
ttaactggattgcccagatgtgttggttgtagtgcaatcaactatactcaatccaaat |
175 |
Q |
| |
|
| | |||| ||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
41247329 |
t----cgaattgttcagatgtattggttgcagtgcaatcaactatgctcaatccaaat |
41247382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University