View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4278_low_16 (Length: 212)
Name: NF4278_low_16
Description: NF4278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4278_low_16 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 36734663 - 36734875
Alignment:
| Q |
1 |
cttatttgatgaaatattactattcccgttatctcaaagcaaaactaattactatcatttgttattaaaaagaatattataagaacaagctgagatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734663 |
cttatttgatgaaatattactattcccgttatctcaaagcaaaactaattactatcatttgttattaaaaagaatattataagaacaagctgagatatat |
36734762 |
T |
|
| Q |
101 |
ctaagaagtattgaaatttgaatagat-nnnnnnngtctttttgttgtaaaaatgaaagtttattccacaagcataatgagtttatgatcagagaaaaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734763 |
ctaagaagtattgaaatttgaatagataaaaaaaagtctttttattgtaaaaatgaaagtttattccacaagcataatgagtttatgatcagagaaaaaa |
36734862 |
T |
|
| Q |
200 |
ttcttatcttttt |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36734863 |
ttcttatcttttt |
36734875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 190
Target Start/End: Original strand, 36737639 - 36737690
Alignment:
| Q |
139 |
ttttgttgtaaaaatgaaagtttattccacaagcataatgagtttatgatca |
190 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
36737639 |
ttttgttgcaaaaattaaagtttattccacaagcttaatgagtttaggatca |
36737690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University