View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279-Insertion-18 (Length: 93)
Name: NF4279-Insertion-18
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279-Insertion-18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 30 - 93
Target Start/End: Original strand, 48646029 - 48646093
Alignment:
| Q |
30 |
gatggctcttgtgtgtgaataa-ttgtattttgattttgaatgaaggtcttagctctaaacgtgt |
93 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48646029 |
gatggctcttgtgtgtgaataaattgtattttgattttgaatgaaggtcttagctctaaacgtgt |
48646093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 93
Target Start/End: Original strand, 48570243 - 48570271
Alignment:
| Q |
65 |
ttgaatgaaggtcttagctctaaacgtgt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48570243 |
ttgaatgaaggtcttagctctaaacgtgt |
48570271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 93
Target Start/End: Original strand, 8146406 - 8146434
Alignment:
| Q |
65 |
ttgaatgaaggtcttagctctaaacgtgt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8146406 |
ttgaatgaaggtcttagctctaaacgtgt |
8146434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University