View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279-Insertion-19 (Length: 142)
Name: NF4279-Insertion-19
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279-Insertion-19 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 1e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 35006251 - 35006111
Alignment:
| Q |
1 |
atttttgccaaaggaattcaaactatcctcgctattaattctattacttagcatctcatatgtagtttttatgaagaattctccattagaagcttgattc |
100 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35006251 |
atttttgtcaaaggaattcaaacaatcctcgctattaattctattacttagcatctcatatgtagtttttatgaagaattctccattaaaagcttgattc |
35006152 |
T |
 |
| Q |
101 |
tgatggggcacgtccgaggtgtcaggggaaggagattgaaca |
142 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35006151 |
tgatggggcacgtccgaggtgtc-ggggaaggaggttgaaca |
35006111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 26 - 111
Target Start/End: Complemental strand, 16882813 - 16882728
Alignment:
| Q |
26 |
tcctcgctattaattctattacttagcatctcatatgtagtttttatgaagaattctccattagaagcttgattctgatggggcac |
111 |
Q |
| |
|
||||| |||||| || || |||| ||||||||||||| | |||||||| |||| | |||||| |||||| ||||| ||||||||| |
|
|
| T |
16882813 |
tcctcactattatttatagtactcagcatctcatatgcactttttatggagaactatccattggaagctagattcaaatggggcac |
16882728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University