View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279-Insertion-3 (Length: 103)
Name: NF4279-Insertion-3
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279-Insertion-3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 1e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 33226287 - 33226394
Alignment:
| Q |
1 |
gttaaaaataggggcgttctcaattcagtcaagtttt-----gtctac-tagctcaaatattttcttacttggtaatttaaaaatctgcaccaatagaaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
33226287 |
gttaaaaataggggcgttctcaattcagtcaagtttttaagggtatatatagctcaaatattttcttacttggtaattt-aaaatctgcacctatagaaa |
33226385 |
T |
|
| Q |
95 |
tctgctttg |
103 |
Q |
| |
|
||||||||| |
|
|
| T |
33226386 |
tctgctttg |
33226394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University