View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279-Insertion-7 (Length: 80)
Name: NF4279-Insertion-7
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279-Insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 4 - 75
Target Start/End: Complemental strand, 30260511 - 30260440
Alignment:
| Q |
4 |
aaactaactataaagggtaagtctttgtcactaagttatgttatgtgccttcattcgattcttttcttttct |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30260511 |
aaactaactataaagggtaagtctttgtcactaagttatgttatgtgccttcattcgattcttttcttttct |
30260440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University