View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279_high_19 (Length: 206)
Name: NF4279_high_19
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 31803958 - 31803775
Alignment:
| Q |
19 |
gataattgctccgaagaaatttgtttatcgttaaaaattcttgcattttgttcttttcaaatgaaccaaatgctagccaaccaaactacct---nnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31803958 |
gataattgctccgaagaaatttgtttattgttaaaaattcttgcattttgttcttttcaaatgaaccaaatgctagccaaccaaactacctaaaaaaaaa |
31803859 |
T |
 |
| Q |
116 |
nnnnnnnnnnncccacatatttcctttataaagacattagtaccaccaaactgaagcgtgtgaattaatatcaccaaccctttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31803858 |
aaaaaaaaaaaaccacatatttcctttataaagacattagtgccaccaaactgaagcgtgtgaattaatatcaccatccctttg |
31803775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University