View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279_high_3 (Length: 449)
Name: NF4279_high_3
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 8e-99; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 42 - 328
Target Start/End: Original strand, 33225910 - 33226189
Alignment:
| Q |
42 |
ctgcactgaatccatcccttttctttaaatgaaattttattttttgtcaaccccc-acaaaagaatgatgcaaaatgaagtacttatgttaagctctcct |
140 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33225910 |
ctgcactgaatccatcccttt-ctttaaatggaatttgattttttgtcaaccccccacaaaagaatgatgcaaaatgaagtacttatgttaagctca--t |
33226006 |
T |
 |
| Q |
141 |
tttgcagtttatgggagcatatgtggaaccattaatgttgataatcacggaacttttggaagctggtttcactttattagaaacacttaagagagtattt |
240 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
33226007 |
tttgcagtttattggagcatctgtgaaaccatcaatgttgataatcacggaacttttggaagctagtt-cacttta---gaaacactta-gagagtattt |
33226101 |
T |
 |
| Q |
241 |
atctaagttttactttagatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaagccatgcaatga |
328 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
33226102 |
atctaagttttacttttgatatttcttaagcaatggaatatttacatgcaaatgacataattcaccgtgatctaaagccatgcaatga |
33226189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 244 - 316
Target Start/End: Complemental strand, 33227183 - 33227111
Alignment:
| Q |
244 |
taagttttactttagatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaa |
316 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
33227183 |
taagttttacttttgatatttcttaagcaatggaatatttacatgcaaatgacatcattcatcgtgatctaaa |
33227111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 398 - 430
Target Start/End: Original strand, 33226259 - 33226291
Alignment:
| Q |
398 |
gtctactaggagataaaatgttcattttgttaa |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33226259 |
gtctactaggagataaaatgttcattttgttaa |
33226291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 398 - 430
Target Start/End: Complemental strand, 33227027 - 33226995
Alignment:
| Q |
398 |
gtctactaggagataaaatgttcattttgttaa |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33227027 |
gtctactaggagataaaatgttcattttgttaa |
33226995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 10528808 - 10528744
Alignment:
| Q |
1 |
gaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528808 |
gaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
10528744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 244 - 320
Target Start/End: Original strand, 10528090 - 10528166
Alignment:
| Q |
244 |
taagttttactttagatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaagcca |
320 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10528090 |
taagttttgcttttgatatttctcaagctatggagtatttacatgcaaatgacatcattcaccgtgatctaaagcca |
10528166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 398 - 430
Target Start/End: Original strand, 10528251 - 10528283
Alignment:
| Q |
398 |
gtctactaggagataaaatgttcattttgttaa |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10528251 |
gtctactaggagataaaatgttcattttgttaa |
10528283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 258 - 319
Target Start/End: Original strand, 7469712 - 7469773
Alignment:
| Q |
258 |
gatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaagcc |
319 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||| || |||||||||||||| ||||| |
|
|
| T |
7469712 |
gatatttcacaagcaatggaatatctgcatgcaaatggaataattcaccgtgatctcaagcc |
7469773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University