View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279_high_9 (Length: 315)
Name: NF4279_high_9
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 6 - 308
Target Start/End: Complemental strand, 41588219 - 41587920
Alignment:
| Q |
6 |
gagacagtcaatgtgttagaagaacaaggtgctgcagttgcaagtggtgatggtgtggagaggacattcaagcggactacacggtctgcgactatgaaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
41588219 |
gagacagtcaatgtgttagaagaacaaggtgctgcagttgcaagtggtgatggtgtggggaggacattcaatcggactatgcggtctgcaactatgaaag |
41588120 |
T |
|
| Q |
106 |
caaatgctgggtccggtgaggagacagtgacgaagttagaccaaaaaggtgctgctgctgttgagagtgaaattgatggtgcattagctgttcggagaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588119 |
caaatgctgggtccggtgaggagacagtgacgaagttagaccaagaaggtgctgctg---ttgagagtgaaattgatggtgcattagctgttcggagaaa |
41588023 |
T |
|
| Q |
206 |
caagatggagttgaagatgtcgaagaagattgcagttgataagaagcggcctacaacaatgaaggagctctttcgtaccggtttactcgatagtgtctct |
305 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41588022 |
caagatggagttgaagacgtcgaagaagattgcagttgataagaagcggcctacaacaatgaaggagctctttcgtaccggtttactcgatggtgtctct |
41587923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 41588336 - 41588294
Alignment:
| Q |
18 |
gtgttagaagaacaaggtgctgcagttgcaagtggtgatggtg |
60 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
41588336 |
gtgttagaacaacaaggtgctgcagttgcaactggtaatggtg |
41588294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University