View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279_low_13 (Length: 276)
Name: NF4279_low_13
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 15000912 - 15001170
Alignment:
| Q |
17 |
tcctccaatgactgcaacattatatttgaatttcttaggataaaagttaataaacacataaatatgaaaccttcatagatagatgcaaattaagacagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
15000912 |
tcctccaatgactgcaacattatatttgaatttgttaggagaaaagttaataaacacataaatatgaaaccttcgtagatagattcaaattaagacagaa |
15001011 |
T |
 |
| Q |
117 |
agtcgttatttttagatttgttgaatgaaaatgattataagattcataacggcaaagtaacctcgtagagttcttttggtataagattcatatgatatgc |
216 |
Q |
| |
|
| |||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15001012 |
aatcgtaatttt-agatttgttgaatgaaaatgattatacgattcataacggcaaagtaacctcgtagagttcttttggtataagattcatatggtatgc |
15001110 |
T |
 |
| Q |
217 |
gtataaaatttgatcgtttacatgctgatacaggtcaacggcagggcttgcaagcacata |
276 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15001111 |
atataaaacttgatcgtttacatgctgatacaggtcaacggcagggcttgcaagcacata |
15001170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University