View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4279_low_19 (Length: 238)
Name: NF4279_low_19
Description: NF4279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4279_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 28035941 - 28035735
Alignment:
| Q |
13 |
gagtagcaaagggagagaatttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttact |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035941 |
gagtatcaaagggagagaatttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttact |
28035842 |
T |
 |
| Q |
113 |
atttgtcatacaattacagaatcaagagctcttttgtgtttcgcggttttgttggaaaagggtacagatgatgtgcaacattattcagcaatggctttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28035841 |
atttgtcatacaattacagaatcaagagctcttttgtgttttgcggttttgttggaaaagggtactgatgatgtgcaacattattcagcaatggctttga |
28035742 |
T |
 |
| Q |
213 |
tggaaat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
28035741 |
tggaaat |
28035735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University