View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-16 (Length: 57)
Name: NF4280-Insertion-16
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 23561374 - 23561419
Alignment:
| Q |
12 |
tattaaaccagcacacagcatacaccttctaaatttggattacttg |
57 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23561374 |
tattaaaccagcacacaacatacaccttctaaatttggattacttg |
23561419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University