View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-17 (Length: 152)
Name: NF4280-Insertion-17
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 8e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 8e-47
Query Start/End: Original strand, 54 - 152
Target Start/End: Original strand, 4403032 - 4403130
Alignment:
| Q |
54 |
acctaaaagttttcttcaagcctctaaacatgagtgttggcaaaaggctatgaaaactgaacttgattcacatgctttgaacaatacatggtccattgt |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4403032 |
acctaaaagttttcttcaagcctctaaacatgagtgttggcaaaaggctatgaaaactgaacttgattcacttgctttgaacaatacatggtccattgt |
4403130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 17883048 - 17882941
Alignment:
| Q |
1 |
aattgtacctcttcctataaaaatttatgtctaactattagtacttcagttgaacctaaaagttttcttcaagcctctaaacatgagtgttggcaaaagg |
100 |
Q |
| |
|
|||||| | ||||| ||||||||||| ||||| || ||| |||| ||||||| |||| |||| |||||||||| |||||||| |||||||| || | |
|
|
| T |
17883048 |
aattgttcttcttcttataaaaatttctgtctttctgttactactaaccttgaacccaaaacttttattcaagcctcaaaacatgaatgttggcagaatg |
17882949 |
T |
|
| Q |
101 |
ctatgaaa |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
17882948 |
ctatgaaa |
17882941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University