View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-20 (Length: 137)
Name: NF4280-Insertion-20
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 41309333 - 41309469
Alignment:
| Q |
1 |
acccctagggttgctccagtggtataggtttgagacgtgttcctctttaagtctcaggtccgaatcctcgagtattaatgattcccatgttgaacaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||| |||||||||| |||| ||||| |
|
|
| T |
41309333 |
acccctagggttgctccagtggtataggtttgagacgtgttcctctttaagtcttaggttcgaatcttcgagtattaacgattcccatgctgaataaata |
41309432 |
T |
 |
| Q |
101 |
agtacatgattgaacctccgataatatacaatgtgat |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41309433 |
agtacatgattgaacctccgataatagacaatgtgat |
41309469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University