View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-21 (Length: 121)
Name: NF4280-Insertion-21
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-21 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 36747622 - 36747742
Alignment:
| Q |
1 |
cctttcttaactcatcaatcacacaagtttatttatttatttttgtagagtaccaatcacacaagttaaattctacaagttgct-aaaaaaccttttaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||| ||||| || |
|
|
| T |
36747622 |
cctttcttaactcatcaatcacacaagtttatttatttatttttg-agagtaccaatcattcaagttaaattctacaagttgctaaaaaaagctttttca |
36747720 |
T |
|
| Q |
100 |
aatgaagaacaaatcatcaatt |
121 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36747721 |
aatgaagaacaaatcatcaatt |
36747742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 53 - 84
Target Start/End: Original strand, 45359869 - 45359900
Alignment:
| Q |
53 |
ccaatcacacaagttaaattctacaagttgct |
84 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
45359869 |
ccaatcacacaagtaaaattctacaagttgct |
45359900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University