View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-24 (Length: 102)
Name: NF4280-Insertion-24
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-24 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 2708790 - 2708692
Alignment:
| Q |
4 |
aactttgttggttactttgcagaaaatcaaatgttttcacaacaacgctgttatggagctaatgcgaggtattcgatatcagttgacagaacttgtaac |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2708790 |
aactttgttggttactttgcagaaaatcaaatgttttcacaacaacgctgttatggagctaatgcgaggtattcgatatcagttgacagaacttgtaac |
2708692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 20 - 96
Target Start/End: Complemental strand, 2702835 - 2702759
Alignment:
| Q |
20 |
ttgcagaaaatcaaatgttttcacaacaacgctgttatggagctaatgcgaggtattcgatatcagttgacagaact |
96 |
Q |
| |
|
|||||||||||| | ||| |||||| ||| |||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
2702835 |
ttgcagaaaatcgactgtgttcacagcaatgctgttatggagataatgcgaggtattcgatatcagttgacggaact |
2702759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University