View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-33 (Length: 88)
Name: NF4280-Insertion-33
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 29771430 - 29771516
Alignment:
| Q |
1 |
caacacccatcagctactacttttatccgctcttaaaagcatgcacgagtagtctccatataaagacacttttaactaaattgtacg |
87 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29771430 |
caacacccatcagctactacttttatctgctcttaaaagcatgcacgagtagtctccatataaagacactttcaactaaattgtacg |
29771516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 29774554 - 29774633
Alignment:
| Q |
8 |
catcagctactacttttatccgctcttaaaagcatgcacgagtagtctccatataaagacacttttaactaaattgtacg |
87 |
Q |
| |
|
|||| ||| ||||||| | | |||||||||||||||||||||||| |||||||||| |||||||| | |||||| ||||| |
|
|
| T |
29774554 |
catcggcttctactttgaactgctcttaaaagcatgcacgagtagcctccatataacgacactttcatctaaatcgtacg |
29774633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University