View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-36 (Length: 67)
Name: NF4280-Insertion-36
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 1726260 - 1726194
Alignment:
| Q |
1 |
aatcactcagccattaaattaaaataattgttgagattggactggttaaagctgcagcatcaacaga |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1726260 |
aatcactcagccattaaattaaaataattgttgagattggactggttaaagctgcagcatcaacaga |
1726194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University