View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-41 (Length: 226)
Name: NF4280-Insertion-41
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 33 - 146
Target Start/End: Complemental strand, 6802243 - 6802130
Alignment:
| Q |
33 |
tcatattcataaaacacatttaaaatctcttggttgatgataaaatataaaagaaaatcatattcaaaagtatttccttataagcaacattttcagtaac |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6802243 |
tcatattcataaaacacatttgaaatctcttggttgatgataaaatataaaagaaaataattttcaaaagtatttccttataagcaacattttcagtaac |
6802144 |
T |
|
| Q |
133 |
atagcaaagccaaa |
146 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6802143 |
atagcaaagccaaa |
6802130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 139 - 226
Target Start/End: Complemental strand, 6802096 - 6802009
Alignment:
| Q |
139 |
aagccaaantgaataatgaaagaccagtgacatatcatttcttttttagagcaaatacatttccaaaattgatttatctctcttctta |
226 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6802096 |
aagccaaagtgaatcatgaaagaccagtgacatatcatttcttttttagagaaaatacatttccaaaattgatttatctctcttctta |
6802009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 139 - 226
Target Start/End: Complemental strand, 6483997 - 6483911
Alignment:
| Q |
139 |
aagccaaantgaataatgaaagaccagtgacatatcatttcttttttagagcaaatacatttccaaaattgatttatctctcttctta |
226 |
Q |
| |
|
|||||||| |||| |||||||| ||||| |||||||||||||||| |||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
6483997 |
aagccaaaaggaatcatgaaagatcagtggcatatcatttctttttcagagaaaatacatttccaaaattga-taatctctcttctta |
6483911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 226
Target Start/End: Original strand, 7606335 - 7606368
Alignment:
| Q |
193 |
atacatttccaaaattgatttatctctcttctta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7606335 |
atacatttccaaaattgatttatctctcttctta |
7606368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University