View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-43 (Length: 238)
Name: NF4280-Insertion-43
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 64142 - 64356
Alignment:
| Q |
23 |
attaacatacatatagaaaaacaacaatggggacaaaatttcaatttccgttttaatgaatgaaaaattcactatgattgtgtttctttaacttattatt |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
64142 |
attaacatacatatagaaaaacaaaaatggggacaaaatttcaatttccgttttaatgaatgaaaaattcactatgattgtgtttctttaacttattatt |
64241 |
T |
|
| Q |
123 |
agttaatggaatcatcattcactaattggcattgtataaattacaaggatttgtaaaattgtgtcat-nnnnnnnngttatggcttgcgtcgaaaataaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
64242 |
agttaatggaatcatcattcactaattggcattgtataaattacaaggatttgtaaaattgtgtcataaaaaaaaagttatgacgtgcgtcgaaaataaa |
64341 |
T |
|
| Q |
222 |
atgtttgtcgtcaca |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
64342 |
atgtttgtcgtcaca |
64356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University