View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-47 (Length: 112)
Name: NF4280-Insertion-47
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-47 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0160 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 9e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 9546076 - 9545966
Alignment:
| Q |
2 |
aaaaatatcaatgttactgaaaagaaaattcatgaatgtccaatttgttttagagaattttcttcaggtcaagcactaggtggacataggagaacacata |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546076 |
aaaaatatcaatgttagtgaaaagaaaattcatgaatgtccaatttgttttagagaatttgcttcaggtcaagcactaggtggacataggagaacacata |
9545977 |
T |
|
| Q |
102 |
atattggattc |
112 |
Q |
| |
|
||||||||||| |
|
|
| T |
9545976 |
atattggattc |
9545966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 19675 - 19594
Alignment:
| Q |
19 |
tgaaaagaaaattcatgaatgtccaatttgttttagagaattttcttcaggtcaagcactaggtggacataggagaacacat |
100 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||| ||| |||| ||| ||||||||||| |||||||| | ||||||||| |
|
|
| T |
19675 |
tgaaaagaaagttcatgaatgtccggtatgttttcgagtatttaattcgggtcaagcacttggtggacacaaaagaacacat |
19594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University