View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-51 (Length: 149)
Name: NF4280-Insertion-51
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 48243664 - 48243812
Alignment:
| Q |
1 |
gtaataacaaatattctcttttacaatcaaatagtgtaaaacttatttgctaccaatcaaatcagttcaatacgttaattttttaagttgagttttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48243664 |
gtaataacaaatattctcttttacaatcaaatagtgtaaaacttatttgctaccaatcaaatcagttcaatacgttaattttttaagttgagttttaaaa |
48243763 |
T |
 |
| Q |
101 |
tatctttacaaatatctattcaacatgatttgtgtgaattgcactggaa |
149 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48243764 |
tatctttacaaatatccattcaacatgatttgtgtgaattgcactggaa |
48243812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University