View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-53 (Length: 252)
Name: NF4280-Insertion-53
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-53 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 9477418 - 9477669
Alignment:
| Q |
1 |
aaataatcacttcaaatcctaatctccaccaccacctttcattcttgattacaaattaaaagggtttgccgaaatcacttccaacacccatcgcctcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9477418 |
aaataatcacttcaaatcctaatctccaccaccacctttcattcttgattacaaattaaaagggttcgccgaaatcacttccaacacccatcgcctcata |
9477517 |
T |
 |
| Q |
101 |
caccgccgaaatcagctccggctccaccctctcgtttggaccccacaacttcttccaaaggtttcgatgtgggactatattaaaagtcaaacttggtaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9477518 |
caccgccgaaatcagctccggctccaccctctcgtttggaccccacaacttcttccaaaggtttcgatgtgggactatattaaaagtcaaacttggtaga |
9477617 |
T |
 |
| Q |
201 |
ttgatagttaattatagcatgttttaattaaagacgtaagtggtggcaggac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9477618 |
ttgatagttaattatagcatgttttaattaaagacgtaagtggtggcaggac |
9477669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University