View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-55 (Length: 204)
Name: NF4280-Insertion-55
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 6 - 77
Target Start/End: Original strand, 39823077 - 39823148
Alignment:
| Q |
6 |
attcatgggtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823077 |
attcatgggtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg |
39823148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University