View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-59 (Length: 66)
Name: NF4280-Insertion-59
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32944967 - 32944919
Alignment:
| Q |
1 |
tattttatttaaattgcatgtgatattctaactgttacttgattttcat |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32944967 |
tattttatttaaattccatgtgatattctaactgttacttgattttcat |
32944919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University