View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280-Insertion-61 (Length: 163)
Name: NF4280-Insertion-61
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280-Insertion-61 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 6e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 5 - 163
Target Start/End: Original strand, 55162793 - 55162951
Alignment:
| Q |
5 |
aacgtgcagtgatgtaaattctagcgttgacgcttatatctcgcgaataagagaactaagacaatatggtgtttttatggatggaattggtctcgagggt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162793 |
aacgtgcagtgatgtaaattctagcgttgacgcttatatctcgcgaataagagaactaagacaatatggtgtttttatggatggaattggtctcgagggt |
55162892 |
T |
 |
| Q |
105 |
cacttcacaataccaaatcttccacttataagagctatcctagacaaattggcaacact |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162893 |
cacttcacaataccaaatcttccacttataagagctatcctagacaaattggcaacact |
55162951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University