View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280_high_23 (Length: 251)
Name: NF4280_high_23
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280_high_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 8019042 - 8019279
Alignment:
| Q |
14 |
caaaatgcaaacaagaaatatgcagcttcaatgaagagtcaaccttgtactcgatagacaactcagcctcaactgaagcattcaacataacattcatacc |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8019042 |
caaaatgcaaacaagaaatatgcaacttcaatgaagagtcaaccttgtgctcgatagacagctcagcctcaactgaaacattcaacataacattcatacc |
8019141 |
T |
 |
| Q |
114 |
ttcaaaacaccaatnnnnnnnnnnnncaataagaaattatcgtcttggtgcaacctcatctcaatttaaattcatcggttagattaccatttactaatac |
213 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019142 |
ttcaaaacaccgataaaaaacaaaaacaataagaaatgatcgtcttgctgcaacctcatctcaatttaaattcatcggttagattaccatttactaatac |
8019241 |
T |
 |
| Q |
214 |
caaaattgatgccaaagtaacgtacatcatagtccatc |
251 |
Q |
| |
|
| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
8019242 |
cgaaattgatgccgaagtaacatacatcatagtccatc |
8019279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University