View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4280_high_27 (Length: 224)

Name: NF4280_high_27
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4280_high_27
NF4280_high_27
[»] chr3 (1 HSPs)
chr3 (16-209)||(39091987-39092181)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 39092181 - 39091987
Alignment:
16 atactatgagcatccataacgggagtatatggggtggatgtggctaattatctttacagtatgttaatccttcattaccttcaattgtcatttggtagta 115  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
39092181 atactatgagcatccataacgggagtatatggagtggatgtggctaattatctttacagtatgttgatccttcattaccttcaattgtcatttggtagta 39092082  T
116 ctcatggctaactttacaagaaggg-attggcttggatcatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataa 209  Q
    |||||||||||||||||||||||||   ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39092081 ctcatggctaactttacaagaagggtcctggcttggaccatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataa 39091987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University