View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280_low_10 (Length: 321)
Name: NF4280_low_10
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 105 - 213
Target Start/End: Complemental strand, 12546843 - 12546735
Alignment:
| Q |
105 |
tgaaggttaacctatggttatcttgtaacaatgctcttttctactgtttcttaattgaattgaatatcattttcctaagatctttgttaataattgtcaa |
204 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
12546843 |
tgaaggttaacccatggttatcttgtgacaatgctctgttctactgtttcttaattgaattgaatatcattttcctatgttctttgttaataattgtcaa |
12546744 |
T |
|
| Q |
205 |
ttttatttg |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
12546743 |
ttttatttg |
12546735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 19 - 141
Target Start/End: Original strand, 12537143 - 12537266
Alignment:
| Q |
19 |
ttcttagttagggttatgtttagtttcaatgtcaaataaaa-ttagggtttggtttatgattttgatgttgtttttatattctgtattgaaggttaacct |
117 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| |||| |||||||| |
|
|
| T |
12537143 |
ttcttagttagggctatgtttagtttcactgtcaaataaaaattagggtttggtttatgattttgatgtagttttaatattctgtaatgaaagttaacct |
12537242 |
T |
|
| Q |
118 |
atggttatcttgtaacaatgctct |
141 |
Q |
| |
|
|| |||||||| |||||||||||| |
|
|
| T |
12537243 |
attgttatcttttaacaatgctct |
12537266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University