View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280_low_20 (Length: 269)
Name: NF4280_low_20
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 29 - 252
Target Start/End: Complemental strand, 6273868 - 6273645
Alignment:
| Q |
29 |
aaagaaatgtatgcacaatgttatagtaaatttgtaagaattacggtgaacaagtatgattatggcatatagatcatgcattaagtatagttttataatg |
128 |
Q |
| |
|
|||||||||| ||||| || ||||||| |||||| ||||||||| ||||| | | ||||| || || ||| |||||||||| |||||| ||||||||| |
|
|
| T |
6273868 |
aaagaaatgtgtgcacgatattatagttaatttgccagaattacgatgaaccactgtgattctgtcagatacatcatgcatttagtataattttataatt |
6273769 |
T |
|
| Q |
129 |
aaaatagaaaataaatatgactcaccttgtcatcaatgaacctcgaccaaaatcgagccaaggctttctcataaggttgttgagggaaaataggatagtt |
228 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6273768 |
aaaatagaaaataaataggactcaccttgtcatcaatgaatctagaccaaaatcgagccaaggctttctcatagggttgttgagggaaaataggatagtt |
6273669 |
T |
|
| Q |
229 |
ctcccatgtttcatcaatgtattc |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6273668 |
ctcccatgtttcatcaatgtattc |
6273645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 23840588 - 23840629
Alignment:
| Q |
152 |
accttgtcatcaatgaacctcgaccaaaatcgagccaaggct |
193 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
23840588 |
accttgtcatcgatgaatttcgaccaaaatcgagccaaggct |
23840629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University