View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280_low_31 (Length: 216)
Name: NF4280_low_31
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 10 - 199
Target Start/End: Original strand, 40420438 - 40420625
Alignment:
| Q |
10 |
tgagaagaaggagatggatgtgaatcaaattattaagcaggaaaaatagttatactgcagaatnnnnnnnnntgttatgagtattaatcagagaaattta |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||| | ||||||||| |
|
|
| T |
40420438 |
tgagatgaaggagatggatgtgaatcaaattattaagcgggaaaaatagttataccgcagaataaaaaaa--tgttatgagtattactataagaaattta |
40420535 |
T |
 |
| Q |
110 |
aagatggtcaactgttaactaggaaaataatggtacagaaggctacgactattttgatttgactgccacgcaaaaggctagggataaagc |
199 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40420536 |
aagatagtcaactgttaactaggcaaataatggtacagaaggctacgactattttgatttgactgccacggcaaaggctagggataaagc |
40420625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University