View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4280_low_9 (Length: 352)
Name: NF4280_low_9
Description: NF4280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4280_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 48275933 - 48276278
Alignment:
| Q |
1 |
caatacaatacaatatactacagtacaatttacgaaaccggttttttctccttatcttcagcttatgtgttaaatcaatgtttatctcattttaacacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48275933 |
caatacaatacaatatactacagtacaatttacgaaaccgtttttttctccttatcttcagcttatgggttaaatcaatgtttatctcattttaacacaa |
48276032 |
T |
|
| Q |
101 |
tattatcacctactacactaccgatttaaaatcttgggttggtagaaagttttatac-----nnnnnnnnngattcatttgcaagtttggtgtttgatga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48276033 |
tattatcacctactacactaccgatttaaaatcttgggttggtagaaagttttatacttttttttttttttgattcatttgcaagtttggtgtttgatga |
48276132 |
T |
|
| Q |
196 |
attaatacatacttctaagaaattcaaagggtacctttcaactttatacttctttgtttctcacacatctttaccactttttattttctctctcacaccc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276133 |
attaatacatacttctaagaaattcaaagggtacctttcaactttatacttctttgtttctcacacatctttaccactttttattttctctctcacaccc |
48276232 |
T |
|
| Q |
296 |
ctttggcatgttgctgnnnnnnnnnaacagatattgattcttctca |
341 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48276233 |
ctttggcatgttgctgtttttttttaacagatattgattcttctca |
48276278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University