View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281-Insertion-12 (Length: 178)
Name: NF4281-Insertion-12
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281-Insertion-12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 6560235 - 6560057
Alignment:
| Q |
1 |
actcacttagttacaaattcccttctttacaccctctttttattgtgagaatcaaagtgcagttgcactgagttaaaattctgtcatg-tattacggaat |
99 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| | | ||||| |
|
|
| T |
6560235 |
actcacttagttacaaattcctttctttacaccttctttttattgtgagaatcaaagtgcagttgcacttagttaaaactctgtcatgcaacttcggaaa |
6560136 |
T |
|
| Q |
100 |
aag-aagtggagctagatttgtaatttggcaaagagaaggttcttagcatgactcatactctcacacgtggtcaaccac |
177 |
Q |
| |
|
||| | |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6560135 |
aagcacatggagctagatttgtactttggcaaagaaaaggttcttagcatgactcatactctcacacatggtcaaccac |
6560057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 178
Target Start/End: Original strand, 13493582 - 13493654
Alignment:
| Q |
106 |
tggagctagatttgtaatttggcaaagagaaggttcttagcatgactcatactctcacacgtggtcaaccact |
178 |
Q |
| |
|
|||||||||||||||| ||| || | || |||||||||||||| ||||||| |||||| |||||||||||| |
|
|
| T |
13493582 |
tggagctagatttgtactttctcagataggaggttcttagcatggttcatactgtcacacatggtcaaccact |
13493654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University