View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281-Insertion-14 (Length: 155)
Name: NF4281-Insertion-14
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281-Insertion-14 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 42122530 - 42122384
Alignment:
| Q |
1 |
caaaatattgtaaaataactgttatagcagctatagcactgttgcgtaatgtgatttgaacaaaccgctatttttcgtgatacataattaacaacactac |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42122530 |
caaaatattataaaataactgttatagcagct--------gttgcgtaatgtgatttgaacaaaccgctatttttcgtgatacataattaacaacactaa |
42122439 |
T |
|
| Q |
101 |
tgcaaatggctttatggtgcactcggttgcatactacagtcttaactaattgaat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42122438 |
tgcaaatggctttatggtgcactcggttgcatactacagtcttaactaattgaat |
42122384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 30 - 75
Target Start/End: Original strand, 36114312 - 36114357
Alignment:
| Q |
30 |
gctatagcactgttgcgtaatgtgatttgaacaaaccgctattttt |
75 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36114312 |
gctatagcactgttgcgtaatgaaatttgaacaaacaactattttt |
36114357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 54 - 98
Target Start/End: Complemental strand, 1668378 - 1668334
Alignment:
| Q |
54 |
atttgaacaaaccgctatttttcgtgatacataattaacaacact |
98 |
Q |
| |
|
||||||||||||||||||||| |||||| || |||| |||||||| |
|
|
| T |
1668378 |
atttgaacaaaccgctattttccgtgattcacaattgacaacact |
1668334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 30617256 - 30617212
Alignment:
| Q |
30 |
gctatagcactgttgcgtaatgtgatttgaacaaaccgctatttt |
74 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
30617256 |
gctatagcattgttgcgtagtggaatttgaacaaaccgctatttt |
30617212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 7347767 - 7347802
Alignment:
| Q |
30 |
gctatagcactgttgcgtaatgtgatttgaacaaac |
65 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7347767 |
gctatagtactgttgcgtaatgtaatttgaacaaac |
7347802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University