View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281-Insertion-2 (Length: 44)
Name: NF4281-Insertion-2
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-17
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28184288 - 28184245
Alignment:
| Q |
1 |
ctctttgggtttgatttcttctagaaaaacaaacgaggctattg |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28184288 |
ctctttgggtttgatttcttctagaaaaacaaacgaggctattg |
28184245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 27; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 27; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 40945131 - 40945161
Alignment:
| Q |
1 |
ctctttgggtttgatttcttctagaaaaaca |
31 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
40945131 |
ctctttgggtttgatttcttcgagaaaaaca |
40945161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University