View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281-Insertion-3 (Length: 125)
Name: NF4281-Insertion-3
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281-Insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 43489655 - 43489546
Alignment:
| Q |
12 |
caaacatgaccttagggcttagaccatataactatgaaacatgaaactctccacacgcatgtatgtggttgcctttcaactaaattatcagccatagaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43489655 |
caaacatgaccttagggcttagaccatatatctatgaaacatgaaactctccacacgcatgtatgtggttgcctttcaactaaattatcagccatagaat |
43489556 |
T |
|
| Q |
112 |
gaaatcatat |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
43489555 |
gaaatcatat |
43489546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University