View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281-Insertion-5 (Length: 114)
Name: NF4281-Insertion-5
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281-Insertion-5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 5054035 - 5054147
Alignment:
| Q |
2 |
aaaattgcccatggtaatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgtgtttgatgtctcttccaagtagagatact |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5054035 |
aaaattgcccatggtaatgccctcgatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgtgtttgatgtctcttccaagtagagatact |
5054134 |
T |
|
| Q |
102 |
ttaaagatgattt |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5054135 |
ttaaagatgattt |
5054147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 68
Target Start/End: Complemental strand, 46446222 - 46446193
Alignment:
| Q |
39 |
tgtttggtcttgacattgtaaccaaaatgt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46446222 |
tgtttggtcttgacattgtaaccaaaatgt |
46446193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 6e-19; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 6e-19
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 39576614 - 39576559
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgt |
72 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
39576614 |
aatgccctcaatctttgtcaattgtttggtcttgacattgtaactaaaatgtatgt |
39576559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 3561339 - 3561389
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatg |
67 |
Q |
| |
|
||||||||| ||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
3561339 |
aatgccctctatctttgtcaatcgtctagtcttgacattgtaaccaaaatg |
3561389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 225608 - 225560
Alignment:
| Q |
19 |
tgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatg |
67 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||| |||||| |
|
|
| T |
225608 |
tgccctcaatctttgtcagttgtctagtcttgacattgtaactaaaatg |
225560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 39572614 - 39572559
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgt |
72 |
Q |
| |
|
|||| ||||||||||||| || |||||||| |||| ||||||| ||||||||||| |
|
|
| T |
39572614 |
aatgtcctcaatctttgtaaattgtttggttttgatattgtaattaaaatgtatgt |
39572559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.000000000009; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.000000000009
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 9842243 - 9842188
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgt |
72 |
Q |
| |
|
|||| |||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
9842243 |
aatgtcctcaatctttgtcaattgcctggtcttcacattgtaaccaaaatgtatgt |
9842188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 9903172 - 9903122
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatg |
67 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||| |||||||||| |||||| |
|
|
| T |
9903172 |
aatgtcctcaatctttatcaattgtttggtcttcacattgtaacaaaaatg |
9903122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 9860884 - 9860829
Alignment:
| Q |
17 |
aatgccctcaatctttgtcaaatgtttggtcttgacattgtaaccaaaatgtatgt |
72 |
Q |
| |
|
||||||||| ||| ||||||| ||| | || |||||||||||||||||||| |||| |
|
|
| T |
9860884 |
aatgccctcgatcattgtcaattgtctagttttgacattgtaaccaaaatgaatgt |
9860829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University