View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281_low_13 (Length: 273)
Name: NF4281_low_13
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281_low_13 |
 | |
|
| [»] scaffold0094 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 53 - 201
Target Start/End: Complemental strand, 37882609 - 37882464
Alignment:
| Q |
53 |
acgagcagaacctgtgttgtattgcaacaaccttcacagtcttcatataaaacgtttattgataatcatcnnnnnnnnatttcatagattagagaaaatt |
152 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37882609 |
acgagcagcaactgtgttgtattgcaacaaccttcacagtcttcatataaaacgtttattgataatcatcttttt---atttcatagattagagaaaatt |
37882513 |
T |
|
| Q |
153 |
ttaacaagttaaggatattaagagatagtgagttggaaacaaggtaaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37882512 |
ttaacaagttaaggatattaagagatagtgagttggaaacaagggaaac |
37882464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 37882299 - 37882383
Alignment:
| Q |
189 |
aaacaaggtaaacccaatgggaaccaaaaacgggagggtaccacattgacattggtcatggtcgagaagaaaaacggcgcacgga |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37882299 |
aaacaaggtaaacccaatgggaaccaaaaacgggagggtaccacattgacattggtcatggtagagaagaaaaacggcgcacgga |
37882383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 189 - 243
Target Start/End: Complemental strand, 41887 - 41833
Alignment:
| Q |
189 |
aaacaaggtaaacccaatgggaaccaaaaacgggagggtaccacattgacattgg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41887 |
aaacaaggtaaacccaatgggaaccaaaaacgggagggtaccacattgatattgg |
41833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University