View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281_low_14 (Length: 271)
Name: NF4281_low_14
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 35857172 - 35857034
Alignment:
| Q |
10 |
catcatcacatggttggaagctttgatgacggtgccacagtacaggaatttgcaaagaggttcgttcatgttactttgaattatgtcatttaactcatat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35857172 |
catcatcacatggttggaagctttgatgacagcgccacagtacaggaatttgcaaagaggttcgttcatgttactttgaattatgtcatttaactcatat |
35857073 |
T |
|
| Q |
110 |
tctcttta----tgtacgtatcacttaattgaaataatg |
144 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| |
|
|
| T |
35857072 |
tctctttatgtatgtatgtatcacttaattgaaataatg |
35857034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 31200862 - 31201000
Alignment:
| Q |
14 |
atcacatggttggaagctttgatgacggtgccacagtacaggaatttgcaaagaggttcgttcatgttactttgaattatgtcat---ttaactcatatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||| ||||||| || ||||||||| |
|
|
| T |
31200862 |
atcacatggttggaagctttgatgacatcgccacagtacaggaatttgcaaagaggttcattcaagttacttcgaatcatgtcatttgttgactcatatt |
31200961 |
T |
|
| Q |
111 |
ctctttatgtacgtatcacttaattgaaataatgcgtgc |
149 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
31200962 |
ctctttatgtctgtatcacttaattgaaataatgtgtgc |
31201000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 182 - 254
Target Start/End: Complemental strand, 35857012 - 35856940
Alignment:
| Q |
182 |
tggtttgaaatggtgttcaggtgtgatgttttaacgtttgaaattgagcacgtcgatgttactacattggaaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35857012 |
tggtttgaaatggtgttcaggtgtgatgttttaacatttgaaattgagcacgtcgatgttactacattggaaa |
35856940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 254
Target Start/End: Original strand, 31201019 - 31201060
Alignment:
| Q |
213 |
taacgtttgaaattgagcacgtcgatgttactacattggaaa |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31201019 |
taacgtttgaaattgagcatgtcgatgttactacattggaaa |
31201060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University